View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13142_low_15 (Length: 244)
Name: NF13142_low_15
Description: NF13142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13142_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 53794301 - 53794075
Alignment:
| Q |
1 |
tgtgcaaatattagtggtctagacatgctttaatgacaaattctaaagtcattaattgtctgaaataatgggttgccacaactgtttaacatagcannnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
53794301 |
tgtgcaaatattagtggtctagacatgctttaatgacaaattctaaagtcattaattgtctcaaataatggtttgccacaactgtttaacatagcatttt |
53794202 |
T |
 |
| Q |
101 |
nnngtaagaagcaaagagaaacttttattaaaataaactgcatggcggagcacaagatattataagatgatgctaaatacaggagaagagcaaaatctgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
53794201 |
tttgtaagaagcaaagagaaacttttattaaaataaactgcatggcggagcaccagatattataagatgatgctaaatacaggacaagaacaaaatctgc |
53794102 |
T |
 |
| Q |
201 |
ggaagacaaagcaccctgaatacacca |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
53794101 |
ggaagacaaagcaccctgaatacacca |
53794075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University