View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13143_high_6 (Length: 369)
Name: NF13143_high_6
Description: NF13143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13143_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 6e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 191 - 357
Target Start/End: Complemental strand, 8407681 - 8407515
Alignment:
| Q |
191 |
gttgtctcaaatcaaacttgttcttaatttctaaaactgccggagactgaacttacagcatccattagctgctttatttcagattcactaagcttggatc |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8407681 |
gttgtctcaaatcaaacttgttcttaatttctaaaactgccggagactgaacttacagcatccattagctgctttatttcagattcactaagcttggatc |
8407582 |
T |
|
| Q |
291 |
ccaatttggacagtccagattttagttcttcatatgtgattgtgccacttcgatcagtatctatatt |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8407581 |
ccaatttggacagtccagattttagttcttcatatgtgattgtgccacttcgatcggtatctatatt |
8407515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 17 - 61
Target Start/End: Complemental strand, 8407866 - 8407822
Alignment:
| Q |
17 |
agaaaaaagaccagaaacactagtgtctgtttgatgtgagaaaat |
61 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8407866 |
agaaaaaagatcagaaacactagtgtctgtttgatgtgagaaaat |
8407822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University