View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13143_high_6 (Length: 369)

Name: NF13143_high_6
Description: NF13143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13143_high_6
NF13143_high_6
[»] chr1 (2 HSPs)
chr1 (191-357)||(8407515-8407681)
chr1 (17-61)||(8407822-8407866)


Alignment Details
Target: chr1 (Bit Score: 163; Significance: 6e-87; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 191 - 357
Target Start/End: Complemental strand, 8407681 - 8407515
Alignment:
191 gttgtctcaaatcaaacttgttcttaatttctaaaactgccggagactgaacttacagcatccattagctgctttatttcagattcactaagcttggatc 290  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8407681 gttgtctcaaatcaaacttgttcttaatttctaaaactgccggagactgaacttacagcatccattagctgctttatttcagattcactaagcttggatc 8407582  T
291 ccaatttggacagtccagattttagttcttcatatgtgattgtgccacttcgatcagtatctatatt 357  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
8407581 ccaatttggacagtccagattttagttcttcatatgtgattgtgccacttcgatcggtatctatatt 8407515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 17 - 61
Target Start/End: Complemental strand, 8407866 - 8407822
Alignment:
17 agaaaaaagaccagaaacactagtgtctgtttgatgtgagaaaat 61  Q
    |||||||||| ||||||||||||||||||||||||||||||||||    
8407866 agaaaaaagatcagaaacactagtgtctgtttgatgtgagaaaat 8407822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University