View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13143_low_4 (Length: 386)
Name: NF13143_low_4
Description: NF13143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13143_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 86 - 371
Target Start/End: Complemental strand, 32325473 - 32325187
Alignment:
| Q |
86 |
ccattgttcttactgagcttcctttc-aactaatacattttcagatgagtaccctatcttgcttccacttgagtcttccacagaactattatctccacgt |
184 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32325473 |
ccattgttcttactgagcttcctttccaactaatacattttcagatgagtaccctatcttgcttccacttgagtcttccacagaactattatctccacgt |
32325374 |
T |
 |
| Q |
185 |
aaaacttcatcgatatcggtagagttgatgccttcaacatccattgtcttctcatgaaaatagtttctcccattaaccaaacaaggacttagaacgatca |
284 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32325373 |
aaaacttcatcggtatcggtagagttgatgccatcaacatccattgtcttctcatgaaaatagtttctcccattaaccaaacaaggacttacaacgatca |
32325274 |
T |
 |
| Q |
285 |
ccacaacaaccagaaccatcgcaaatactactctcataatccccatctcttgcctaattattaagcacttcccaataatgcatatat |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32325273 |
ccacaacaaccagaaccatcgcaaatactactctcataatccccatctcttgcctaattattaagcacttcccaataatgcatatat |
32325187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University