View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13145_high_7 (Length: 327)
Name: NF13145_high_7
Description: NF13145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13145_high_7 |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0028 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 311
Target Start/End: Complemental strand, 126053 - 125743
Alignment:
| Q |
1 |
agaatacctgcttccttcaggcatgacatctggcttcctgtatgtgtgacaattggctgcggctttgtttgacaagtggacagctccattaagtgacacg |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
126053 |
agaatacctgcttcctccaggcatgacatttggtttcctatatgtgtgacaattggctgcggctttgtttgacaagtggacagctccattaagtgacacg |
125954 |
T |
 |
| Q |
101 |
tgagcatttgagttaaagagagggttccaaaggagaaaaggcttcaacttccgtaagggagggaaagcagggaaatccaacaaaagattttgaaaaggtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
125953 |
tgagcatttgagttaaagagagggttccaaaggagaaaaggcttcaacttccgtaagggagggaaagcatggaaatccaacaaaagattttgaaaaggtg |
125854 |
T |
 |
| Q |
201 |
ttttgaataaagcatatgtcacttgagttgtacttacacttgctgagaaagagaaactctcttttcaaatcttctccttgcaaactcagttctaccatct |
300 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
125853 |
ttttgaataaagcatatgtcacttcagttgtacttacacttgctgagaaagagaaactctcttttcaaatcttctccttgcaaactcagttctaccatct |
125754 |
T |
 |
| Q |
301 |
ctctcttcatt |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
125753 |
ctctcttcatt |
125743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University