View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13145_high_8 (Length: 286)
Name: NF13145_high_8
Description: NF13145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13145_high_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 19 - 286
Target Start/End: Original strand, 42202840 - 42203107
Alignment:
| Q |
19 |
aacggcagctccggcagtaacgacggtgccagagaagaagaagagaggaagaccgagaaagtatgcagcggatggttcggtgacggcagcgttgtctccg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42202840 |
aacggcagctccggcagtaacgacggtgccagagaagaagaagagaggaagaccgagaaagtatgcagcggatggttcggtgacggcagcgttgtctccg |
42202939 |
T |
 |
| Q |
119 |
aaaccgatatcatcgtcggctccgttgccgccggtgatcgatttcacggcggagaagcgtgcaaaagtgaagccagttagttctgtgagcaaagcgaatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42202940 |
aaaccgatatcatcgtcggctccgttgccgccggtgatcgatttcacggcggagaagcgtgcaaaagtgaagccagttagttctgtgagcaaagcgaatt |
42203039 |
T |
 |
| Q |
219 |
ttgagttggaaaatataggtactgcttctaactagaatatctctattttgttgtctactttttatttt |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42203040 |
ttgagttggaaaatataggtactgcttctaactagaatatctctattttgttgtctactttttatttt |
42203107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 132 - 206
Target Start/End: Complemental strand, 13926582 - 13926508
Alignment:
| Q |
132 |
cgtcggctccgttgccgccggtgatcgatttcacggcggagaagcgtgcaaaagtgaagccagttagttctgtga |
206 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||| ||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
13926582 |
cgtctgctccgttgccgccggtgatcaatttcatggcggagaagcgtgcaaaagtgaagtcagttagctctgtga |
13926508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 132 - 198
Target Start/End: Original strand, 12523826 - 12523892
Alignment:
| Q |
132 |
cgtcggctccgttgccgccggtgatcgatttcacggcggagaagcgtgcaaaagtgaagccagttag |
198 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12523826 |
cgtctgctccgttgccgccggtgatcaatttcatggcggagaagcgtgcaaaagtgaagccagttag |
12523892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 137 - 206
Target Start/End: Original strand, 32060695 - 32060764
Alignment:
| Q |
137 |
gctccgttgccgccggtgatcgatttcacggcggagaagcgtgcaaaagtgaagccagttagttctgtga |
206 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
32060695 |
gctccgttgccgccggtgatcaatttcatggcggagaagcgtgcaaaaatgaagccagttagctctgtga |
32060764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University