View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13145_low_10 (Length: 246)
Name: NF13145_low_10
Description: NF13145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13145_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 21 - 231
Target Start/End: Original strand, 3565449 - 3565659
Alignment:
| Q |
21 |
aagaatactggaggaagaacattttattctcaatagctagtggtgctggttcgccaattttcactgattctgccacaaccaaacttatctatgaaagaac |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||| |
|
|
| T |
3565449 |
aagaatactggaggaagaacattttattctcaatagctagtggtgctggttcgccaattttcactgattctaccacagccaaacttatgtatgaaagaac |
3565548 |
T |
|
| Q |
121 |
ctttggatattaggctagagtcttagtagatcttgatatttcccaacctttaagacacaaaatgttagttgaaagaaaagactttacattctatgtagaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3565549 |
ctttggatattaggctagagtcttagtagatcttgatatttcccaacctttaagacacaaaatgttagttgaaagaaaaggttttacattctatgtagaa |
3565648 |
T |
|
| Q |
221 |
ctttcctatga |
231 |
Q |
| |
|
||||||||||| |
|
|
| T |
3565649 |
ctttcctatga |
3565659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University