View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13145_low_11 (Length: 239)
Name: NF13145_low_11
Description: NF13145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13145_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 6413447 - 6413311
Alignment:
| Q |
1 |
ccagaaagaaaaacgcaattgggtatccgaatctgaatcgnnnnnnnnnnnngatctgatttttgaggttgatcacaataacaacaataaccgatcaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6413447 |
ccagaaagaaaaacgcaattgggtatccgaatctgaatcgaaaaaagaaaaagatctgatttttgaggttgatcacaatatcaacaataaccgatcaaag |
6413348 |
T |
|
| Q |
101 |
agtccaatgtgaaaaaggggcttaatagtcaaaaggg |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6413347 |
agtccaatgtgaaaaaggggcttaatagtcaaaaggg |
6413311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University