View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13146_low_4 (Length: 335)
Name: NF13146_low_4
Description: NF13146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13146_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 18 - 325
Target Start/End: Original strand, 22905171 - 22905478
Alignment:
| Q |
18 |
catgacagtcaaacgtttggaaggattgtttttaaatcgtgcaaaattgtgcaacgacaacctataaagtagctagcgtctatgctttgcacattaactt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22905171 |
catgacagtcaaacgtttggaaggattgtttttaaatcgtgcaaaattgtgcaacgacaacctataaagtagctagcgtctatgctttgcacattaactt |
22905270 |
T |
 |
| Q |
118 |
aggtcttactaaacggaccctctatctatggctctttcaacaggtcttgaacggatctattctaaagcactataaatggagcttctccgtaactgttgaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
22905271 |
aggtcttactaaacggaccctctatctatggctctttcaacaggtcttgaacggatctattctaaagcactataaacggagcttctccgtaaatgttgaa |
22905370 |
T |
 |
| Q |
218 |
gttgatgaaattttttaagagaatattgagaaactatttggcatcaatcaagatgaacacaagccgaaatgccattgaaaacaatacttcatttttatat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22905371 |
gttgatgaaattttttaagagaatattgagaaactatttggcatcaatcaagatgaacacaagccgaaatgccattgaaaacaatacttcatttttatat |
22905470 |
T |
 |
| Q |
318 |
cctctctg |
325 |
Q |
| |
|
|||||||| |
|
|
| T |
22905471 |
cctctctg |
22905478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University