View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13147_high_11 (Length: 238)
Name: NF13147_high_11
Description: NF13147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13147_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 33707410 - 33707187
Alignment:
| Q |
1 |
tgtctctttaaacccttttttgnnnnnnnggttgttgtcactattgggccgattacgacagagattgagtttgtatttgagtgatataaaatcagagaga |
100 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33707410 |
tgtctctttaaacccttttttgaaaaaaag-ttgttgtcactattgggccgattacgacagagattgagtttgtatttgagtgatataaagtcagagaga |
33707312 |
T |
 |
| Q |
101 |
gattgttctaattatcttgtcttaagaagatatcaaggtaactgtgttaagacaacttgattgatgtacatatgatctaaggactcttcta--agcggat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||| |
|
|
| T |
33707311 |
gattgttctaattatcttgtcttaagaagatatcaaggtaactgtgttaagacaacttgattgatgtacctatgatctaaggactcttttaagagcggat |
33707212 |
T |
 |
| Q |
199 |
atacaatgaattcttagattgatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33707211 |
atacaatgaattcttagattgatgt |
33707187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University