View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13147_low_11 (Length: 238)
Name: NF13147_low_11
Description: NF13147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13147_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 17 - 213
Target Start/End: Original strand, 22958928 - 22959124
Alignment:
| Q |
17 |
ataaggaaagaaaagtatagtaattatttggtgtatactttatcgtaaaacttgttatagtttctagtttttgaattaaaatagtga--nnnnnnnnctc |
114 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
22958928 |
ataaggaaagaaaagtacagtaattatttggtgtatactttat--taaaacttgttatagtttctagtttttgaattaaaataatgattttttttttctc |
22959025 |
T |
|
| Q |
115 |
ttaggtggtcaaagacgaaacatgtcaactttgcttttgaccatcatagatagttgttgataaaggatttttggccaattgattttactctagcatagt |
213 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| |||||||| |||||| ||| | |||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
22959026 |
ttagatggccaaagacgaaacatgtcaactttacttttgactatcatatataatggttgataaaggatttttgaccaattggttttactctagcatagt |
22959124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University