View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13148_high_3 (Length: 243)
Name: NF13148_high_3
Description: NF13148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13148_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 12 - 151
Target Start/End: Complemental strand, 42227205 - 42227066
Alignment:
| Q |
12 |
tattggtaaataattgttaatttannnnnnnaattcaagtaagnnnnnnnctattttggtcgcaagagtgaatatttttctgtcaaatgatttgcattga |
111 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42227205 |
tattggtaaataattgttaatttatttttttaattcaagtaagaaaaaaactactttggtcgcaagagtgaatatttttctgtcaaatgatttgcattga |
42227106 |
T |
 |
| Q |
112 |
tgatttctaccattagcttcctccctgaaccttccgccat |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42227105 |
tgatttctaccattagcttcctccctgaaccttccgccat |
42227066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University