View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13148_low_4 (Length: 218)
Name: NF13148_low_4
Description: NF13148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13148_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 20 - 200
Target Start/End: Complemental strand, 30242655 - 30242475
Alignment:
| Q |
20 |
aggatgaggatgaagaggttttgcgtgattcgaagtcacgcaacnnnnnnnnnnnntttaaagtaaagtggagacttgtttttgaatggatactatttct |
119 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30242655 |
aggatgaggacgaagaggttttgcgtgattcgaagtcacacaacaaaaagaaaaaatttaaagtaaagtggagacttgtttttgaatggatattatttct |
30242556 |
T |
|
| Q |
120 |
aaacatattaacatgtttggtttgttctgtcacaataagaggaataacaaacatgcatttattagggttagaggtttggag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30242555 |
aaacatattaacatgtttggtttgttctgtcacaataagaggaataacaaacatgcatttattagggttagaggtttggag |
30242475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University