View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13149_high_10 (Length: 440)
Name: NF13149_high_10
Description: NF13149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13149_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 15 - 154
Target Start/End: Complemental strand, 5574073 - 5573934
Alignment:
| Q |
15 |
caaacactatcactgttctatggtaaaatcagtggtgttcccccacaaacatggacggtgccaaatatgcccacttactaatatttgcccataccacatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5574073 |
caaacactatcactgttctatggtaaaatcagtggtgttcccccacaaacatggacggtgccaaatatgcccacttactaatatttgcccataccacatt |
5573974 |
T |
 |
| Q |
115 |
tatcaattgttcgtgttatagattagagaatccttcgaag |
154 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
5573973 |
tatcaattggtcgtgttatagatcagagaatccttcgaag |
5573934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 180 - 346
Target Start/End: Complemental strand, 5573902 - 5573736
Alignment:
| Q |
180 |
tcgataaaattttatcttctcatgtgataatattattttttagccannnnnnnnnnn-agggaattattttttaggcaatgaaaaactactttccttaca |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5573902 |
tcgataaaattttatcttctcatgtgataatattattttttagccatttttttttttgagggaatgattttttaggcaatgaaaaactactttccttaca |
5573803 |
T |
 |
| Q |
279 |
catataatattacannnnnnnncttcttataagttccctctattcaaagcgtgttggacatgaatata |
346 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5573802 |
catataatattaca-tttttttcttcttataagttccctctattcaaagcgtgttggacatgaatata |
5573736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 392 - 425
Target Start/End: Complemental strand, 7792338 - 7792305
Alignment:
| Q |
392 |
tcaaacctcaaattttacatatattatgcattgt |
425 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
7792338 |
tcaaacctcagattttacatatattatgcattgt |
7792305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University