View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13149_high_18 (Length: 247)
Name: NF13149_high_18
Description: NF13149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13149_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 29007110 - 29007336
Alignment:
| Q |
1 |
cacaaacacatgcatcaggatattgacaatg-tacaattcactgatacgttttcgatcacaagtgtcggtgctcttgacgtgtcgattgcaca--acaca |
97 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29007110 |
cacaaacacatgcatcaggatattgaaaatgatacaattca--gatacgttttcgatcacaagtgtcggtgctcttgacgtgtcgattgcacagcacaca |
29007207 |
T |
 |
| Q |
98 |
agaaaacgtgtttaagctgaattataagttataatcgaagtgtatttattgtgtaaatgttgttgattacatttgcatttgaattgtacagggttgatgt |
197 |
Q |
| |
|
| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29007208 |
aaaaaatgtgtttaagctgaattataagttataatcgaagtgtatttattgtgtaaatgttgttgattgcatttgcatttgaattgtacagggttgatgt |
29007307 |
T |
 |
| Q |
198 |
tatgtgcagttgtgtcgttgagttcaatt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29007308 |
tatgtgcagttgtgtcgttgagttcaatt |
29007336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University