View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13149_high_25 (Length: 205)

Name: NF13149_high_25
Description: NF13149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13149_high_25
NF13149_high_25
[»] chr2 (2 HSPs)
chr2 (102-186)||(2480113-2480197)
chr2 (49-100)||(2480034-2480085)


Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 102 - 186
Target Start/End: Original strand, 2480113 - 2480197
Alignment:
102 gatgagaaggcaaattttaggaggaacaaaggcaagaccattgtgaaagaaggtataacttcattggaaagcatagtcaaacata 186  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2480113 gatgagaagacaaattttaggaggaacaaaggcaagaccattgtgaaagaaggtataacttcattggaaagcatagtcaaacata 2480197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 49 - 100
Target Start/End: Original strand, 2480034 - 2480085
Alignment:
49 attgttatgcaaaatcctgaaaaatttcggggctctcataccaaaaatgtgg 100  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||    
2480034 attgttatgcaaaatcctgaaaaatttcagggctctcataccaaaaatgtgg 2480085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University