View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13149_low_21 (Length: 237)

Name: NF13149_low_21
Description: NF13149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13149_low_21
NF13149_low_21
[»] chr8 (1 HSPs)
chr8 (21-164)||(43102926-43103061)


Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 43102926 - 43103061
Alignment:
21 aacatcatggacaccatggaacgagaatagaaaataagagctgttatgggcctatggctattgggaaaacaaggatcgttagggatttcatttcttccat 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||        |||||||| ||| |||| ||| ||||||||||||||||||||||    
43102926 aacatcatggacaccatggaacgagaatagaaaataagagctgttatg--------gctattggaaaagcaagcatcattagggatttcatttcttccat 43103017  T
121 gatggttgaaaaggaacatgtatttggtttggtgtggtcactta 164  Q
    ||||||||||||||||||||||||||||||||||| ||||||||    
43103018 gatggttgaaaaggaacatgtatttggtttggtgtagtcactta 43103061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University