View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13149_low_21 (Length: 237)
Name: NF13149_low_21
Description: NF13149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13149_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 43102926 - 43103061
Alignment:
| Q |
21 |
aacatcatggacaccatggaacgagaatagaaaataagagctgttatgggcctatggctattgggaaaacaaggatcgttagggatttcatttcttccat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |||| ||| |||||||||||||||||||||| |
|
|
| T |
43102926 |
aacatcatggacaccatggaacgagaatagaaaataagagctgttatg--------gctattggaaaagcaagcatcattagggatttcatttcttccat |
43103017 |
T |
|
| Q |
121 |
gatggttgaaaaggaacatgtatttggtttggtgtggtcactta |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43103018 |
gatggttgaaaaggaacatgtatttggtttggtgtagtcactta |
43103061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University