View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13149_low_24 (Length: 216)
Name: NF13149_low_24
Description: NF13149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13149_low_24 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 64 - 216
Target Start/End: Original strand, 2155799 - 2155951
Alignment:
| Q |
64 |
ttttttgtgttcaaatttatatttacattttaaatgccatttcttgttagacaagccatatggagtaacagnnnnnnnngacatgtacttatggagtttt |
163 |
Q |
| |
|
|||||||||| |||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2155799 |
ttttttgtgtccaaatttaaaattacattttaaatgccatttctagttagacaagccatatggagtaacagaaaaaaaagacatgtacttatggagtttt |
2155898 |
T |
|
| Q |
164 |
cttgcttacgtcggattgatgtataattgcatcatcatattatattcatgtat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2155899 |
cttgcttacgtcggattgatgtataattgcatcatcatattatattgatgtat |
2155951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University