View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_103 (Length: 255)
Name: NF1314_high_103
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_103 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 32 - 91
Target Start/End: Complemental strand, 35356795 - 35356736
Alignment:
| Q |
32 |
ttaagacattttccgaacaaattcttgcgtttctgcggaggatctcaacccttcttgatc |
91 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35356795 |
ttaagacattttctgaacaaattcttgcgtttctgcggaggatctcaaccctttttgatc |
35356736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 169 - 226
Target Start/End: Complemental strand, 35356657 - 35356600
Alignment:
| Q |
169 |
agggaccgcaacaaatataaaccgaaggtaatggtttataatcagttgatgtatatgt |
226 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35356657 |
agggaccacaacaaatataaaccgaaggtaatggtttataattagttgatgtatatgt |
35356600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University