View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_113 (Length: 251)
Name: NF1314_high_113
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_113 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 8 - 251
Target Start/End: Complemental strand, 35308423 - 35308180
Alignment:
| Q |
8 |
cgaataatatagtaaagaatgaagctgccaaccaagcttaaccctcgataagaaaaactaactcactaccgcaaaattaatcgagtcgggtca---aaca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
35308423 |
cgaataatatagtaaagaatgaagctgccaaccaagcttaaccctcgataagaaaaactaactcactaccgcaaaattaatcgagtggggtcagacgaca |
35308324 |
T |
 |
| Q |
105 |
ttgttgttgtaggccactttattttgtccaatacgaatatattcacttataaataataactattctatatattgtnnnnnnntccaattaaatacaaaac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||| ||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
35308323 |
ttgttgttgtaggccactttattttgtccaataccaatatatttgcttata---aataactattctatacattgtgaaaaaatccaattaaatacaaaac |
35308227 |
T |
 |
| Q |
205 |
tattttttatattttatctctttatcgatatgtctttgttttacttt |
251 |
Q |
| |
|
||||||| ||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
35308226 |
tatttttgatattttatctttttatcaatatgtctttgttttacttt |
35308180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University