View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_114 (Length: 251)
Name: NF1314_high_114
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_114 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 1769241 - 1769483
Alignment:
| Q |
9 |
gagatgaaattgaaagtggaatattcccggaaaatttgttgtgagaaagttcgagaataataaggttttttaagaaagtgaaaatatcaggtatgttacc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1769241 |
gagatgaaattgaaagtggaatattcccggaaaatttgttgtgagaaagttggagaataataaggttttttaaggaagtgaaaatatcaggtatgttacc |
1769340 |
T |
 |
| Q |
109 |
actaagttggtttccttggagactaaggtatgtgagatttgttaggtttttaagggatactggaatggttcctgtgagaaatttgttacctagttttaac |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1769341 |
actaagttggtttccttggagactaaggtatgtgagatttgttaggtttttaagggatactggaatggttcctgtgagaaaattgttacctagttttaac |
1769440 |
T |
 |
| Q |
209 |
tgagttactttagtcaatgcagatattgaactaggagttggtc |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
1769441 |
tgagttaatttagtcaatgcagatattgaactaggaattggtc |
1769483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University