View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_117 (Length: 251)
Name: NF1314_high_117
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_117 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 9 - 232
Target Start/End: Complemental strand, 45548718 - 45548494
Alignment:
| Q |
9 |
tcgaagaatatgatgttataagggatacagaaaagcatatccttagtatacttctggatgagatcgccaaagaatattgcacattcaaggagcgctgatt |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45548718 |
tcgaaaaatatgatgttataagggatacagaaaagcatatccttagtatacttctggatgagatcgccaaagaatattgcacattcaaggagcgctgatt |
45548619 |
T |
|
| Q |
109 |
gaatatgacaaccatactatggaagttttttatg-tatttgcaatacaattttgttggttgtaagtttgtaactggtgaggagttctgaacagcaagttt |
207 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45548618 |
gaatatgacaaccatactatgaaagttttttatgttatttgcaatacaattttgttggttgtaagtttgtaactggtgaggagttctgaacagcaagttt |
45548519 |
T |
|
| Q |
208 |
tcattagaaagaagagtttcctcct |
232 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45548518 |
tcattagaaagaagagtttcctcct |
45548494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University