View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_123 (Length: 250)
Name: NF1314_high_123
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_123 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 29 - 242
Target Start/End: Original strand, 6286084 - 6286297
Alignment:
| Q |
29 |
ttcgtaacatgagagaacatggttgaaattacacataagatagtcttaaaatgcatgtagtatttcaatgaacatgtaaaatcaaactttggtaaatcac |
128 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |||| | |||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
6286084 |
ttcgtaacatgagagtacatggttgaaattacacataagatagtcttagaatgtaagtagtatttccacgaacatgtaaaatcaaactttggtaaatcac |
6286183 |
T |
 |
| Q |
129 |
aaaattcattatcgattccaacttaggccatttaaaagaaaatatgttattagcctgacacatttttcattatgtgtcagggatagtggtatggaagctt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6286184 |
aaaattcattatcgattccaacttaggccatttaaaagaaaatatgttattagcctgacacatttttcattatgtgtcagggatagtggtatggaagctt |
6286283 |
T |
 |
| Q |
229 |
tgattgttcatctc |
242 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
6286284 |
tgattgttcgtctc |
6286297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University