View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_134 (Length: 214)
Name: NF1314_high_134
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_134 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 3 - 119
Target Start/End: Complemental strand, 42340948 - 42340832
Alignment:
| Q |
3 |
gattgccttccgagcgatgaagaaatgacattgttgacgtcattcctggtcgcttcttctccttccctctgcaatgattctacctccccttgttgccaat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42340948 |
gattgccttccgagcgatgaagaaatgacattgttgacgtcattcctgatcgcttcttctccttccctttgcaatgattctacctccccttgttgccaat |
42340849 |
T |
 |
| Q |
103 |
tcatctcaccttctctt |
119 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42340848 |
tcatctcaccttctctt |
42340832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University