View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1314_high_135 (Length: 213)

Name: NF1314_high_135
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1314_high_135
NF1314_high_135
[»] chr7 (1 HSPs)
chr7 (3-119)||(42340832-42340948)


Alignment Details
Target: chr7 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 3 - 119
Target Start/End: Complemental strand, 42340948 - 42340832
Alignment:
3 gattgccttccgagcgatgaagaaatgacattgttgacgtcattcctggtcgcttcttctccttccctctgcaatgattctacctccccttgttgccaat 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||    
42340948 gattgccttccgagcgatgaagaaatgacattgttgacgtcattcctgatcgcttcttctccttccctttgcaatgattctacctccccttgttgccaat 42340849  T
103 tcatctcaccttctctt 119  Q
    |||||||||||||||||    
42340848 tcatctcaccttctctt 42340832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University