View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_139 (Length: 209)
Name: NF1314_high_139
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_139 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 25334423 - 25334543
Alignment:
| Q |
1 |
caaatcatttgggttattccttttgattgcttggaatctctcacaactcattcctccatgccatggaactttgcacttcgcgcaaaagcgtctattacac |
100 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |||| |
|
|
| T |
25334423 |
caaatcattagggttactccttttgattgcttggaatctctcacaactcattcctccatgccacggaactttgcacttcgcgcaaaagcgtctgtgacac |
25334522 |
T |
|
| Q |
101 |
gagggacacttagaagaacat |
121 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
25334523 |
gaaggacacttagaagaacat |
25334543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 25345498 - 25345584
Alignment:
| Q |
1 |
caaatcatttgggttattccttttgattgcttggaatctctcacaactcattcctccatgccatggaactttgcacttcgcgcaaaa |
87 |
Q |
| |
|
|||||||||| || ||||||||| | | ||||||| ||| |||| |||||||| |||||||||||||||||||||| || ||||| |
|
|
| T |
25345498 |
caaatcatttttgtcattccttttaaattgttggaatttctgacaattcattcctgcatgccatggaactttgcactttgcacaaaa |
25345584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University