View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_21 (Length: 465)
Name: NF1314_high_21
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 3e-49; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 196 - 307
Target Start/End: Complemental strand, 7431822 - 7431711
Alignment:
| Q |
196 |
aatgattcaaatatgataaaactaactttgaagagcttacatcatatagtgatggctgcagcatttcttgactcctgttacctttgtgtttggctaacat |
295 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7431822 |
aatgatgcaaatatgataaaactaactttgaagaggttacatcatatagtgatggctgcagcatttcttgactcctgttaccttggtgtttggctaacat |
7431723 |
T |
 |
| Q |
296 |
agaagtagtggt |
307 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7431722 |
agaagtagtggt |
7431711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 424
Target Start/End: Complemental strand, 7431639 - 7431597
Alignment:
| Q |
382 |
gttggatagaaataactaatatatctgctatgcagtagtaaat |
424 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7431639 |
gttggatagaaataactaatatatcttctatgcagtagtaaat |
7431597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 421 - 453
Target Start/End: Complemental strand, 7431570 - 7431538
Alignment:
| Q |
421 |
aaatttcattctaatgtgaagcttggtgatatt |
453 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7431570 |
aaatttcattctaatgtgaagcttggtgatatt |
7431538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 307
Target Start/End: Original strand, 15837395 - 15837439
Alignment:
| Q |
263 |
ttgactcctgttacctttgtgtttggctaacatagaagtagtggt |
307 |
Q |
| |
|
|||||| |||||||||| ||||||||||||| |||||||| |||| |
|
|
| T |
15837395 |
ttgactgctgttaccttggtgtttggctaacttagaagtattggt |
15837439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University