View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_41 (Length: 399)
Name: NF1314_high_41
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 8e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 141 - 301
Target Start/End: Original strand, 26894033 - 26894193
Alignment:
| Q |
141 |
agggcaatgtattgcaaagcttgaaaggtctcaaataaaaactagccctagcccttgtgcatatagtggnnnnnnntgtgacaaatttttatatcaatgt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26894033 |
agggcaatgtattgcaaagcttgaaaggtctcaaataaaaactagccctagcccttgtgcatatagtggaaaaaaatgtgacaaatttttatatcaatgt |
26894132 |
T |
 |
| Q |
241 |
aaaaaatgtgcacattaacacaagatcaagttttgtcaaaaggggttgtgaaattagcata |
301 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26894133 |
aaaaaatgtccacattaacacaagatcaagttttgtcaaaaggggttgtgaaattagcata |
26894193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University