View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_44 (Length: 389)
Name: NF1314_high_44
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 67 - 352
Target Start/End: Original strand, 10369537 - 10369823
Alignment:
| Q |
67 |
tattctcaacgtgagttaatttacgaagatgaacttcttaatggggatgaacaaaaacaaatg-tagaagagcaattacttttgtcttatgttttgcaat |
165 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| | |||| | || ||||||||||||||||||| |||| |||||||| ||||||||||||||||||||| |
|
|
| T |
10369537 |
tattcttaacgtgagttaacttacgaagatgcatttctcagtgcggatgaacaaaaacaaatggtagagaagcaattatttttgtcttatgttttgcaat |
10369636 |
T |
 |
| Q |
166 |
tcatattttattattatttgtcttgtttcctgttttatatgtgtatattaaattaagcttagaaaattccaatcgatggaggttgtgcttgttgtcttct |
265 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10369637 |
tcatattttattattatttgtcttatttcctgttttatatgtgtatattaaattaagcttagaaaattccaatcgatggaggttgtgcttgttgtcttct |
10369736 |
T |
 |
| Q |
266 |
acgaagtagcccatattagattccttttcttgaaagtggtgtattaattttaaaatttggattgtaggtatattcttgcataatatt |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10369737 |
acgaagtagcccatattagattccttttcttgaaagtggtgtattaattttaaaatttggattgtaggtatattcttgcataatatt |
10369823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University