View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_64 (Length: 331)
Name: NF1314_high_64
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_64 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 28 - 318
Target Start/End: Original strand, 48907318 - 48907616
Alignment:
| Q |
28 |
caatttgatcaccaaattaatagcacatcttaaaatgtatgctctctctttcttatcattaacacatccaacctcacttagtgaataaaacttgattgtt |
127 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48907318 |
caatttgatcgccaaattaatagcacatcttaaaatgtatgctct--ctttcttatcattaacacatccaacctcacttagtgaataaaacttgattgtt |
48907415 |
T |
|
| Q |
128 |
gttgttgtttcttatcattgagacagtaaaaacaacaatgttttcttatttataagatgagattagagagataatttaatgagcaaaaggctaagtgctc |
227 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48907416 |
gttgtttcttcttatcattgagacagtaaaaacaacaatgttttcttatttataagatgagattagagagataatttaatgagcaaaaggctaagtgctc |
48907515 |
T |
|
| Q |
228 |
gtttggatgagcg----------ttggacgtatgtttagagggcttaacgtgattttactttattatgaagttgtttggattggaaacgatgaagcggtt |
317 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48907516 |
gtttggatgagcgttggagagcattggacgtctgtttagagggcttaacgtgattttactttattatgaagttgtttggattgaaaacgatgaagcggtt |
48907615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 245 - 305
Target Start/End: Original strand, 38113929 - 38113989
Alignment:
| Q |
245 |
acgtatgtttagagggcttaacgtgattttactttattatgaagttgtttggattggaaac |
305 |
Q |
| |
|
||||| |||| ||| | ||||| |||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
38113929 |
acgtacgtttggagagtttaacatgattttattttattatgaagttgtttggattgaaaac |
38113989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University