View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_73 (Length: 317)
Name: NF1314_high_73
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_73 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 30 - 302
Target Start/End: Original strand, 41580824 - 41581096
Alignment:
| Q |
30 |
ggaatagcccttccaaatgattatccatgatcactgaaacatgatcaaggaatttagcttcacttgttccaggaagtgcagcttcctctgctttgtgaat |
129 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41580824 |
ggaatagcccttctaaatgattatccatgatcactgaaacaagatcaaggaatttagcttcacttgttccaggaagtgcagcttcctctgctttgtgaat |
41580923 |
T |
 |
| Q |
130 |
aatctgctcaatgacagattttttcttcagtgtttctcgacacatgatgcttccaatggtgaaaggagtgagtcctttttctgcacctttctgaagaagc |
229 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41580924 |
aatctgctcaatgacagactttttcttcagtgtttctcgacacatgatgcttccaatggtgaaaggagtgagtcctttttctgcacctttctgaagaagc |
41581023 |
T |
 |
| Q |
230 |
atggttgatatacgaagaatctgggcgcattccagcggaagttcccatccatgagacttcaaaagcttaatat |
302 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41581024 |
atggttgatatacgaagaatccgggcgcattccagcggaagttcccatccatgagacttcaaaagcttaatat |
41581096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University