View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_85 (Length: 286)
Name: NF1314_high_85
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_85 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 53 - 223
Target Start/End: Original strand, 1610998 - 1611168
Alignment:
| Q |
53 |
agaccagttgctcaaagataatatcttgtagcatactagtttcactacatgggggcgaatttcgctcctagtagaactacaagagggaagtttcaacaca |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1610998 |
agaccagttgctcaaagataatatcttgtagcatactagtttcactacatgggggcgaatttcgctcctagtagaactacaagagggaagtttcaacaca |
1611097 |
T |
 |
| Q |
153 |
tcattgaaaagattcaaaataggttaagtgggtggaagcatcaatgtcttagcttcgctgatagacttact |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1611098 |
tcattgaaaagattcaaaataggttaagtgggtggaagcatcaatgtcttagcttcgccgatagacttact |
1611168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University