View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_89 (Length: 281)
Name: NF1314_high_89
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_89 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 30 - 221
Target Start/End: Original strand, 31903994 - 31904185
Alignment:
| Q |
30 |
aaaaggtaggttggtttggccaatcttctatgatgttgatccttctgatgtgcgaaagcagacgggatcatacagtgaagctttatctatgcttgcagaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||| ||||| ||| ||||||||||| ||||||||| ||| |
|
|
| T |
31903994 |
aaaaggtaggttggtttggccaatcttttatgatgttgatccttctgatgtgaggaagcagacaggatcttacggtgaagctttagctatgcttggagag |
31904093 |
T |
 |
| Q |
130 |
agattcaatgataataacttgcaaatatggaagaatgctttgcaacaagttgctaacttgtctggatggcatttcaaaattgggtaaatacc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31904094 |
agattcaatgataataacttgcaaatatggaagaatgctttgcaacaagtagctaacttgtctggatggcatttcaaaattgggtaactacc |
31904185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 89
Target Start/End: Complemental strand, 9169471 - 9169437
Alignment:
| Q |
55 |
ttctatgatgttgatccttctgatgtgcgaaagca |
89 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9169471 |
ttctatgatgttgatccttctgaggtgcgaaagca |
9169437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 89
Target Start/End: Complemental strand, 33288188 - 33288154
Alignment:
| Q |
55 |
ttctatgatgttgatccttctgatgtgcgaaagca |
89 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33288188 |
ttctatgatgttgatccttctgaggtgcgaaagca |
33288154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 89
Target Start/End: Original strand, 17438156 - 17438190
Alignment:
| Q |
55 |
ttctatgatgttgatccttctgatgtgcgaaagca |
89 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17438156 |
ttctatgatgttgatccttctgaggtgcgaaagca |
17438190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University