View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_92 (Length: 276)
Name: NF1314_high_92
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_92 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 30 - 272
Target Start/End: Complemental strand, 17850950 - 17850711
Alignment:
| Q |
30 |
aatataatctcttatttgaatttcaaactcagccatcattaaacttgatcttccacatgcctatgtgaactaaatatggttttcaaattacccaatcata |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |||||||||||||||||||||||||| || |||||| | |
|
|
| T |
17850950 |
aatataatctcttatttgaatttcaaactcaaccatcattaaacttgaccttccacatgtttatgtgaactaaatatggttttcaaactatccaatc--a |
17850853 |
T |
 |
| Q |
130 |
tatctcatatcactgtttccaacatctgtctatccatcttnnnnnnnnnnnnnnnnncagtgttgcatacggctcctagctctatagtcatatttcatag |
229 |
Q |
| |
|
| ||||||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
17850852 |
tctctcatatcactgtttccaacatttgtctaaccatctt---aaaaaaaaaaaaaacagtgttgcatacggctcctaactccatagttatatttcatag |
17850756 |
T |
 |
| Q |
230 |
tt--tctctctaacatcattccaatttccgtcattcttctctctc |
272 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17850755 |
tttctctctctaacatcattccaatttccgtcattcttctctctc |
17850711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University