View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_93 (Length: 271)
Name: NF1314_high_93
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_93 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 51 - 241
Target Start/End: Original strand, 35969058 - 35969233
Alignment:
| Q |
51 |
aaaaaatagtgaactagacctttcaacaggatttcatgccttgttggagtttcgaaacgcctagatcagcccttaaaatttcagaccttaaaatttcaga |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
35969058 |
aaaaaatagtgaactagacctttcaacaggatttcatgccttgttggagtttcgagacgcctagatcagccctt---------------aaaatttcaga |
35969142 |
T |
 |
| Q |
151 |
cctatcaattttaaagtaggccggactttggccttgcaatacctagcttagactaacatattatcaccccctaacaatgtcctggttcatc |
241 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35969143 |
cctatcatctttaaagtaggccggactcaggccttgcaatacctagcttagactaacatattatcaccccctaacaatgtcctggttcatc |
35969233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 146 - 220
Target Start/End: Original strand, 35979269 - 35979343
Alignment:
| Q |
146 |
tcagacctatcaattttaaagtaggccggactttggccttgcaatacctagcttagactaacatattatcacccc |
220 |
Q |
| |
|
||||||||| || |||||||||||||||||||| ||| || ||| ||||| ||||||||| |||||| ||||||| |
|
|
| T |
35979269 |
tcagacctaacatttttaaagtaggccggacttaggcgttacaaaacctaacttagactagcatattctcacccc |
35979343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University