View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_high_96 (Length: 264)
Name: NF1314_high_96
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_high_96 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 52465650 - 52465902
Alignment:
| Q |
1 |
aggacatatttctataagctatctttatcaagtggtaaacatatttctagaagacttatgtttgttgatgtgtgtttctggataatgatttatcagcaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52465650 |
aggacatatttctataagctatctttatcaagtggtaaacatattcctagaagacttatgtttgttgatgtgtgtttctggacaatgatttatcagcaag |
52465749 |
T |
|
| Q |
101 |
tggctcgggtaaagggtgtcatagatcttgaggtcggtgatgaatactaacccgaca-ttttttttattttaggcatattaaccggac---nnnnnnnnn |
196 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||| |
|
|
| T |
52465750 |
tggctcgggtaaagggtgtcgtagatcttgaggtcggtgatgaatactaaccggacatttttttttattttaggcatattaacc-gacattttttttttt |
52465848 |
T |
|
| Q |
197 |
nnnactaaccggacatcttgtatgtagctattctaaacagacttgcagaataat |
250 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52465849 |
tttactaaccggacatcttgtatgtaactattctaaacagacttgcagaataat |
52465902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University