View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_low_105 (Length: 302)
Name: NF1314_low_105
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_low_105 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 42 - 239
Target Start/End: Complemental strand, 13058456 - 13058259
Alignment:
| Q |
42 |
agatgatctccccattgaagatgccataacgaaaaagaccaatttgaccaaaaaattagagttaaatgagttgttttttcttcctaaaattgtaatggat |
141 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
13058456 |
agatgatctccccattgaagatgctataacgaaaaagatcaatttgaccaaaaaattagagttaaatgagttttgttttcttcctaaaattgtaatggat |
13058357 |
T |
|
| Q |
142 |
tttgattttaatccataaataataaaatgtgatgttttcactcttccaaaattttatgttttgttcttggttcaaaatgaacataatttcgatatatt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13058356 |
tttgattttaatccataaataataaaatgtgatgttttcactcttccaaaattttatgttttgttcttggttcaaaatgaacataatttcgatatatt |
13058259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 212
Target Start/End: Complemental strand, 28191785 - 28191713
Alignment:
| Q |
140 |
attttgattttaatccataaataataaaatgtgatgttttcactcttccaaaattttatgttttgttcttggt |
212 |
Q |
| |
|
||||||||||||||| || | ||||||||| |||||||||| || ||||||||| ||||||||| ||||| |
|
|
| T |
28191785 |
attttgattttaatctttacaaaataaaatgagatgttttcatcctcacaaaattttttgttttgtttttggt |
28191713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 1742005 - 1742046
Alignment:
| Q |
140 |
attttgattttaatccataaataataaaatgtgatgttttca |
181 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| |||||||||| |
|
|
| T |
1742005 |
attttgattttaatccctaaaaaataaaatgagatgttttca |
1742046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University