View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_low_122 (Length: 268)
Name: NF1314_low_122
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_low_122 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 31 - 110
Target Start/End: Original strand, 25334406 - 25334485
Alignment:
| Q |
31 |
tccaaaaatatgttatccaaatcatttgggttattccttttgattgcttggaatctctcacaactcattcctccatgcca |
110 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25334406 |
tccaaaaatatggtatccaaatcattagggttactccttttgattgcttggaatctctcacaactcattcctccatgcca |
25334485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 32 - 112
Target Start/End: Original strand, 25345482 - 25345562
Alignment:
| Q |
32 |
ccaaaaatatgttatccaaatcatttgggttattccttttgattgcttggaatctctcacaactcattcctccatgccatg |
112 |
Q |
| |
|
|||||||| | ||||||||||||||| || ||||||||| | | ||||||| ||| |||| |||||||| ||||||||| |
|
|
| T |
25345482 |
ccaaaaatttcttatccaaatcatttttgtcattccttttaaattgttggaatttctgacaattcattcctgcatgccatg |
25345562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University