View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_low_129 (Length: 257)
Name: NF1314_low_129
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_low_129 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 29010250 - 29010352
Alignment:
| Q |
1 |
ttactaaaaacaatgctattgagctttaagtatatggttgatttcactgcggtaaaattaattccaaagggttattgattatgaaaagtttttgattaac |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29010250 |
ttactaaaaactatgctattgagctttaagtatatggttgatttcactgcggtaaaattaattccaaagggttattgattatgaaaagttttttattaac |
29010349 |
T |
 |
| Q |
101 |
ttt |
103 |
Q |
| |
|
||| |
|
|
| T |
29010350 |
ttt |
29010352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University