View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1314_low_129 (Length: 257)

Name: NF1314_low_129
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1314_low_129
NF1314_low_129
[»] chr7 (1 HSPs)
chr7 (1-103)||(29010250-29010352)


Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 29010250 - 29010352
Alignment:
1 ttactaaaaacaatgctattgagctttaagtatatggttgatttcactgcggtaaaattaattccaaagggttattgattatgaaaagtttttgattaac 100  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
29010250 ttactaaaaactatgctattgagctttaagtatatggttgatttcactgcggtaaaattaattccaaagggttattgattatgaaaagttttttattaac 29010349  T
101 ttt 103  Q
    |||    
29010350 ttt 29010352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University