View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_low_130 (Length: 257)
Name: NF1314_low_130
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_low_130 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 257
Target Start/End: Original strand, 47452889 - 47453130
Alignment:
| Q |
18 |
atgaatggaagtatgaggatcggcgtagtctaaggatgttgcaaaagtgacttttcgtctgttccaaggcagctacaaccatgcatgagcattttgttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47452889 |
atgaatggaagtatgaggatcggcgtagtctaaggatgttgcaaaagtgacttttcgtctgttccaaggcagctacaaccatgcatgagcattttgttga |
47452988 |
T |
|
| Q |
118 |
catgttctactttagcctgcattattataatatcgtggagattatttggttgatgtggaatttgtattttggcctgtagttgtgtgtaagactttac--t |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
47452989 |
catgttctactttagcctgcattattataatatcgaggagattgtttggttgatgtggaatttgtattttggcctgtagtagtgtgtaagactttactat |
47453088 |
T |
|
| Q |
216 |
aacatagttatttgttggagaagttatgaaacaacaaaataa |
257 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47453089 |
aacataggtatttgttggagaagttatgaaacaacaaaataa |
47453130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University