View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_low_148 (Length: 251)
Name: NF1314_low_148
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_low_148 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 25 - 251
Target Start/End: Original strand, 42592487 - 42592713
Alignment:
| Q |
25 |
catcacctttatcttgcaaacatcgtaccatgagaagcttgtcttcaggactgaagcttcccattgcaatggctttacccagtttaactaatctagcttt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42592487 |
catcacctttatcttgcaaacatcgtaccatgagaagcttgtcttcaggactgaagcttcccattgcaatggctttacccagtttaactaatctagcttt |
42592586 |
T |
|
| Q |
125 |
gccattcaagtcttgaagttcttttccttcaaggtgtccgtctaccggcacttctattcccagttcacaagctgtttctttcactaccatgatgtcatcc |
224 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42592587 |
gccattcaagtattgaagttcttttccttcaaggtgtccgtctaccggcacttctattcccagttcacaagctgtttctttcactaccatgatgtcatcc |
42592686 |
T |
|
| Q |
225 |
gtcgagaccaatttgatatgtattcca |
251 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42592687 |
gtcgagaccaatttgatatgtattcca |
42592713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 59 - 197
Target Start/End: Complemental strand, 4092258 - 4092120
Alignment:
| Q |
59 |
aagcttgtcttcaggactgaagcttcccattgcaatggctttacccagtttaactaatctagctttgccattcaagtcttgaagttcttttccttcaagg |
158 |
Q |
| |
|
|||||| ||||||| || ||||||||||||||| ||||||||| ||| || | | ||||||||| ||| ||| || | || ||||||||| |||||| |
|
|
| T |
4092258 |
aagcttatcttcagcacagaagcttcccattgctatggctttatccacttcatcgaatctagctccttcatgcaaatccttaaattcttttccctcaagg |
4092159 |
T |
|
| Q |
159 |
tgtccgtctaccggcacttctattcccagttcacaagct |
197 |
Q |
| |
|
|| ||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
4092158 |
tgaccgcctaccggcacttctattcccagttcataagct |
4092120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University