View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_low_165 (Length: 229)
Name: NF1314_low_165
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_low_165 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 57 - 225
Target Start/End: Original strand, 33054234 - 33054407
Alignment:
| Q |
57 |
gatgaggaagaggtggcccatacaccagaatcacaaacatgacagtacac-----aacacaacagcctctcatactttcttcttcagcaatggtcatcac |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33054234 |
gatgaggaagaggtggcccatacaccagaatcacaaacatgacagtacacaacacaacacaacagcctctcatactttcttcttcagcaatggtcatcac |
33054333 |
T |
 |
| Q |
152 |
taccctgtctttcagatacatgggccccacttgcatgtgcattactctccgagttctccccattcatctcactc |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33054334 |
taccctgtctttcagatacatgggccccacttgcatgtgcattactctccgagttctccccattcttctcactc |
33054407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University