View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_low_166 (Length: 228)
Name: NF1314_low_166
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_low_166 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 14 - 188
Target Start/End: Complemental strand, 33054010 - 33053840
Alignment:
| Q |
14 |
tatatacatgcatattaaaaggtggagaacttctacatttatttacaactcattagtatctggaaatttggtaatattcgactttaatatttggacatag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33054010 |
tatatacatgcatattaaaaggtggagaacttctacattta----caactcattagtatctggaaatttggtaatattcgactttaatatttggacatag |
33053915 |
T |
|
| Q |
114 |
tatattcgactttaatattgaaatgtaaatacgtgaacattatgctttttaatactatattcgtctgagttgtat |
188 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33053914 |
tatattcgactttaatattgaagtgtaaatacgtgaacattatgctttttaatactatattcgtctgagttgtat |
33053840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University