View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_low_179 (Length: 208)
Name: NF1314_low_179
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_low_179 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 96 - 199
Target Start/End: Complemental strand, 25516684 - 25516581
Alignment:
| Q |
96 |
ctatttagctgattttgtgatattctcggatatctgtattactatcatttgtgtttacttataggttcctaattctaaatcattgtttagggagggttat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25516684 |
ctatttagctgattttgtgatattctcggatatctgtattactatcatttgtgtttacttataggttcctaattctaaatcattgtttagggagggttat |
25516585 |
T |
 |
| Q |
196 |
aata |
199 |
Q |
| |
|
|||| |
|
|
| T |
25516584 |
aata |
25516581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 25516749 - 25516707
Alignment:
| Q |
1 |
aaatgaaagtatatacatctatatctgctattcgctctgctgg |
43 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||| ||||| |
|
|
| T |
25516749 |
aaatgaaagtatataaatgtatatctgctattcgctccgctgg |
25516707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University