View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1314_low_180 (Length: 208)

Name: NF1314_low_180
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1314_low_180
NF1314_low_180
[»] chr2 (1 HSPs)
chr2 (41-114)||(31381552-31381625)


Alignment Details
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 41 - 114
Target Start/End: Complemental strand, 31381625 - 31381552
Alignment:
41 atctaagtgaccttctagtgaaatcattttgttttttagttatttaatataaatatgaccaatttcatactttg 114  Q
    ||||||||||| |||||||||   |||||| ||||||||||||||||||||||||||||| ||||| |||||||    
31381625 atctaagtgacattctagtgactacattttattttttagttatttaatataaatatgacctatttcgtactttg 31381552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University