View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_low_188 (Length: 201)
Name: NF1314_low_188
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_low_188 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 12683560 - 12683463
Alignment:
| Q |
1 |
tcacatccgccccggctgctggtggcacctgttgctgtggaggccactgctgctccggctgaaccatcaacggtgccatcatcgttccctcaggcctc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683560 |
tcacatccgccccggctgctggtggcacctgttgctgtggaggccactgctgctccggctgaaccatcaacggtgccatcatcgttccctcaggcctc |
12683463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 77
Target Start/End: Original strand, 44553171 - 44553205
Alignment:
| Q |
43 |
gccactgctgctccggctgaaccatcaacggtgcc |
77 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
44553171 |
gccattgctgctccggctgaaccatcaacggtgcc |
44553205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University