View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_low_60 (Length: 376)
Name: NF1314_low_60
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_low_60 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 30 - 367
Target Start/End: Complemental strand, 9681645 - 9681311
Alignment:
| Q |
30 |
ctataggtcttggataagatttcacaccttcttaggttttgagttgggattaattcatcatacgaaaatggcttgttaagtgagaaacacctattctatg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9681645 |
ctataggtcttggataagatttcacacctt---aggttttgagttgggattaattcatgatacgaaaatggcttgttaagtgagaaacacctattctatg |
9681549 |
T |
|
| Q |
130 |
taaagttcnnnnnnngtcgtatcacatccgacatgggactctcaacatttttatttcaatcatgatatttagtaaatgtactcttgcacacatggtttct |
229 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9681548 |
taaagttctttttttgtcgtatcacatccgacatgggactctcaacatttttctttcaatcatgatatttagtaaatgtactcttgcacacatggtttct |
9681449 |
T |
|
| Q |
230 |
cataattttgttgtatgaaagtacaagttgctggcatataatgaatgttatgtgaaatatgaaagggattggaaattaatataccatctaccaatgaagg |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9681448 |
cataattttgttgtatgaaagtacaagttgctggcatataatgaatgttatgtgaaatatgaaagggattggaaattaatataccatctaccaatgaagg |
9681349 |
T |
|
| Q |
330 |
accaccaataggaaccaaagatatttatggatattatt |
367 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
9681348 |
accaccaataggaaccaaagatatttgtggatgttatt |
9681311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University