View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_low_84 (Length: 327)
Name: NF1314_low_84
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_low_84 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 45 - 312
Target Start/End: Complemental strand, 1769893 - 1769626
Alignment:
| Q |
45 |
tgacccagatgatgaatcaggtctattagccttcaaatccggcatcaaatctgacccgacatccatgctcaagtcatggataccgggtacaaattgttgc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1769893 |
tgacccagatgatgaatcaggtctattagccttcaaatccggcatcaaatctgacccgacatccatgctcaagtcatggataccgggtacaaattgttgc |
1769794 |
T |
|
| Q |
145 |
acatgggtaggtgtagggtgtctggtcgacaaacgggtgacaagtttatctttaaccggtgacactgaaaatcctaaaagcttcttgtcaggtacaatct |
244 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1769793 |
acatgggtaggtgtagggtgtctggacaacaaacgggtgacaagtttatctttaaccggtgacactgaaaatcctaaaagcttcttgtcaggtacaatct |
1769694 |
T |
|
| Q |
245 |
caccatcactctcaaaactcaaattccttgatggaatctacttgataaacctcctcaaaatttctggt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1769693 |
caccatcactctcaaaactcaaattccttgatggaatctacttgataaacctcctcaaaatttctggt |
1769626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University