View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_low_88 (Length: 320)
Name: NF1314_low_88
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_low_88 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 11 - 237
Target Start/End: Complemental strand, 27008294 - 27008071
Alignment:
| Q |
11 |
gatgaatgattaaattagctatgctaccacataatacatggttgctgcaaagaagtgtgacacgtgagccaacccaatcaaataagggtagttgnnnnnn |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
27008294 |
gatgaatgattaaattagctatgctaccacataatac---gttgctgcaaagaagtgtgacacgtgagccaaccaaatcaaataaggctagttgaaaaaa |
27008198 |
T |
|
| Q |
111 |
ntgacttgcatttttcagttaatcctataagcagggttttaactagattgatacactttgacctttgtaaagaataatcgtgagggaaatgaacaaaaag |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27008197 |
atgacttgcatttttcagttaatcctataagcagggttttaactagattgatacactttgacctttgtaaagaataatcgtgagggaaatgaacaaaaag |
27008098 |
T |
|
| Q |
211 |
cccaaatggtccaattttcactttagc |
237 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
27008097 |
cccaaatggtccaattttcactttagc |
27008071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University