View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_low_93 (Length: 315)
Name: NF1314_low_93
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_low_93 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 121 - 246
Target Start/End: Complemental strand, 21269079 - 21268954
Alignment:
| Q |
121 |
ttatccttcttgggaagtggtgacatgagttcaactttcttcttaatcttctcagcaagattgtctctcagttttgtggggtccacatttccggtgacgg |
220 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21269079 |
ttatccttcttgggaattggtgaaatgagttcaactttcttcttaatcttctcagcaagattgtctctcagttttgtggggtccacatttccggtgacgg |
21268980 |
T |
 |
| Q |
221 |
ttacttttccggtttcactctctgct |
246 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
21268979 |
ttacttttccggtttcactctctgct |
21268954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University