View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1314_low_95 (Length: 314)
Name: NF1314_low_95
Description: NF1314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1314_low_95 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 93 - 314
Target Start/End: Complemental strand, 53249332 - 53249115
Alignment:
| Q |
93 |
gttttatactttctatgtaagtaaggataggaataggctggaccgactgaccgacctagactttacaaataccaaacatggcttggactaacacttcaag |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53249332 |
gttttatactttctatgtaagtaaggataggaataggctggaccgac----cgacctagactttacaaacaccaaacatggcttggactaacacttcaag |
53249237 |
T |
|
| Q |
193 |
gcataggactgatctgtagtctgtcatagtcagaaacttaaatttaggcttgagtctgcaattattttatgaacatatttaaataagcaatattatctat |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53249236 |
gcataggactgatctgtagtctgtcatagtcataaacttaaatttaggcttgagtctgcaattattttatgaacatatttaaataagcaatattatctat |
53249137 |
T |
|
| Q |
293 |
atctaaacaaactaatgcgcta |
314 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
53249136 |
atctaaacaaactaatgcgcta |
53249115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University